Page 49 - Volume 1, Issue 1, January 2008
Basic HTML Version
Phytophthora primulae
47
trees, cotton and ornamentals have been
identified, causing serious soilborne dis-
eases in Greece (6, 7, 10, 11, 12, 13).
The objectives of this study were to
identify the pathogen causing root rot of
parsley, using morphological and molecular
features, and to determine its host range.
Materials and Methods
Pathogen morphology and physiology
Cornmeal agar (CMA) was used to iso-
late the pathogen from diseased parsley
plants, to maintain the cultures and to de-
tect the maximum growth temperature.
Morphological characteristics of the iso-
lates were observed on mounts made af-
ter growth on CMA, pea-broth (200 g fro-
zen pea in 500 mL H
2
O mashed for 5 min
in a blender, the mixture was centrifuged
for 10 min at 3000 rpm and the super-
natant was collected and made up to 1L
with distilled water; the latter was dilut-
ed with distilled water in a ratio 1 to 8 and
then autoclaved at 121
0
C for 20 min) and
soil extract (1g of soil was mixed in 100 mL
of distilled water, left for 24 h, allowed to
sediment and the supernatant was filtered
to obtain the extract). For sporangia pro-
duction the isolates from CMA were trans-
ferred to Petri plates 9 cm in diameter, con-
taining pea-broth medium, incubated for
24 h and then transferred to Petri dishes
containing a shallow layer of soil extract.
The species identification was based
on the morphological and physiological
characteristics using the revised tabular
key for the genus
Phytophthora
and C.M.I.
descriptions (16, 17).
RFLP analysis and PCR sequencing reac-
tion
For sequence analysis of ITS region the
protocol of Cooke and Duncan (2) was fol-
lowed. For DNA extraction, five parsley
isolates (P1, P2, P3, P4, P5) were grown at
20
0
C, each in two Erlenmeyer flasks con-
taining 100 ml pea-broth. Seven days lat-
er and after vacuum filtration the myceli-
umwas freeze-dried and kept at -20
0
C. For
DNA extraction 100 mg mycelium from
each isolate was ground in plastic Eppen-
dorf tubes with 50 mg sterile sand and 750
μL extraction buffer [200 mM 1M Tris-HCl
pH 7.5, 250mM5MNaCl, 25mM0.5MEDTA
pH 8 and 0.5% from 10% SDS (sodium do-
decyl sulfate)]. The samples were centri-
fuged for 5 min at 13.000 rpm; the upper
phase was extracted with 250 μL phenol
and 250 μL iso-amyl alchohol. After cen-
trifigation for 5 min the upper phase was
transferred to new tubes adding 0.54 vol-
umes isopropanol and was centrifuged for
10 min. The DNA pellet was washed with
1000 μL frozen ethanol, air dried and re-
suspended in 100 μL SDW (sterile distilled
water) with RNAse (5 mg/ml) for extended
storage at -20
0
C. DNA concentrations were
determined both spectrophotometrical-
ly and on agarose gels. The PCR amplifica-
tion was conducted on 50 μL mixture that
was overlaid with 30 μL of sterile mineral
oil and subjected to thermal cycling. A sin-
gle round PCR using the universal primers
ITS6 (GAAGGTGAAGTCGTAACAAGG) and
ITS4 (TCCTCCGCTTATTGATATGC) was ap-
plied (5 μL buffer, 6 μL MgCl
2
25 mM, 5 μL
dNTPs 2 mM, 1 μL of each primer 30 pM, 1
μL
Taq
DNA polymerase, 2 μL sample and
29 μL SDW). PCR conditions were a single
denaturation step at 94
0
C for 3 min, fol-
lowed by 35 cycles of annealing at 55
0
C for
30 s, extension at 72
0
C for 60 s, and dena-
turation at 94
0
C for 30 s, with a final exten-
sion step at 72
0
C for 10 min. The reaction
mixture was run on 2% agarose gels then
stained with ethidium bromide and visu-
alized under UV illumination to test the
yield and size of the product.
The PCR products from the isolate P1 in
addition to BPIC1989 isolate of
P. porri
and
BPIC2514 isolate of
P. syringae
, with mor-
phological and physiological similarities
